Eradication of metastatic renal cell carcinoma after adenovirus-encoded TNF-related apoptosis-inducing ligand (TRAIL)/CpG immunotherapy.

Despite evidence that antitumor immunity can be protective against renal cell carcinoma (RCC), few patients respond objectively to immunotherapy and the disease is fatal once metastases develop. We asked to what extent combinatorial immunotherapy with Adenovirus-encoded murine TNF-related apoptosis-inducing ligand (Ad5mTRAIL) plus CpG oligonucleotide, given at the primary tumor site, would prove efficacious against metastatic murine RCC. To quantitate primary renal and metastatic tumor growth in mice, we developed a luciferase-expressing Renca cell line, and monitored tumor burdens via bioluminescent imaging. Orthotopic tumor challenge gave rise to aggressive primary tumors and lung metastases that were detectable by day 7. Intra-renal administration of Ad5mTRAIL+CpG on day 7 led to an influx of effector phenotype CD4 and CD8 T cells into the kidney by day 12 and regression of established primary renal tumors. Intra-renal immunotherapy also led to systemic immune responses characterized by splenomegaly, elevated serum IgG levels, increased CD4 and CD8 T cell infiltration into the lungs, and elimination of metastatic lung tumors. Tumor regression was primarily dependent upon CD8 T cells and resulted in prolonged survival of treated mice. Thus, local administration of Ad5mTRAIL+CpG at the primary tumor site can initiate CD8-dependent systemic immunity that is sufficient to cause regression of metastatic lung tumors. A similar approach may prove beneficial for patients with metastatic RCC.

Adenoviral delivery of VEGF121 early in pregnancy prevents spontaneous development of preeclampsia in BPH/5 mice.

An imbalance in circulating proangiogenic and antiangiogenic factors is postulated to play a causal role in preeclampsia (PE). We have described an inbred mouse strain, BPH/5, which spontaneously develops a PE-like syndrome including late-gestational hypertension, proteinuria, and poor feto-placental outcomes. Here we tested the hypothesis that an angiogenic imbalance during pregnancy in BPH/5 mice leads to the development of PE-like phenotypes in this model. Similar to clinical findings, plasma from pregnant BPH/5 showed reduced levels of free vascular endothelial growth factor (VEGF) and placental growth factor (PGF) compared to C57BL/6 controls. This was paralleled by a marked decrease in VEGF protein and Pgf mRNA in BPH/5 placentae. Surprisingly, antagonism by the soluble form of the FLT1 receptor (sFLT1) did not appear to be the cause of this reduction, as sFLT1 levels were unchanged or even reduced in BPH/5 compared to controls. Adenoviral-mediated delivery of VEGF(121) (Ad-VEGF) via tail vein at embryonic day 7.5 normalized both the plasma-free VEGF levels in BPH/5 and restored the in vitro angiogenic capacity of serum from these mice. Ad-VEGF also reduced the incidence of fetal resorptions and prevented the late-gestational spike in blood pressure and proteinuria observed in BPH/5. These data underscore the importance of dysregulation of angiogenic factors in the pathogenesis of PE and suggest the potential utility of early proangiogenic therapies in treating this disease.

Superoxide Enhances the Antitumor Combination of AdMnSOD Plus BCNU in Breast Cancer.

Overexpression of manganese superoxide dismutase (MnSOD) can sensitize a variety of cancer cell lines to many anticancer drugs. Recent work has shown that cancer cells can be sensitized to cell killing by raising peroxide levels through increased manganese superoxide dismutase (MnSOD) when combined with inhibition of peroxide removal. Here we utilize the mechanistic property of one such anticancer drug, BCNU, which inhibits glutathione reductase (GR), compromising the glutathione peroxidase system thereby inhibiting peroxide removal. The purpose of this study was to determine if anticancer modalities known to produce superoxide radicals can increase the antitumor effect of MnSOD overexpression when combined with BCNU. To enhance MnSOD, an adenoviral construct containing the cDNA for MnSOD (AdMnSOD) was introduced into human breast cancer cell line, ZR-75-1. AdMnSOD infection alone did not alter cell killing, however when GR was inhibited with either BCNU or siRNA, cytotoxicity increased. Futhermore, when the AdMnSOD + BCNU treatment was combined with agents that enhance steady-state levels of superoxide (TNF-α, antimycin, adriamycin, photosensitizers, and ionizing radiation), both cell cytotoxicity and intracellular peroxide levels increased. These results suggest that the anticancer effect of AdMnSOD combined with BCNU can be enhanced by agents that increase generation of superoxide.

Measurement of superoxide dismutase, catalase and glutathione peroxidase in cultured cells and tissue.

Cells contain a large number of antioxidants to prevent or repair the damage caused by reactive oxygen species, as well as to regulate redox-sensitive signaling pathways. General protocols are described to measure the antioxidant enzyme activity of superoxide dismutase (SOD), catalase and glutathione peroxidase. The SODs convert superoxide radical into hydrogen peroxide and molecular oxygen, whereas the catalase and peroxidases convert hydrogen peroxide into water. In this way, two toxic species, superoxide radical and hydrogen peroxide, are converted to the harmless product water. Western blots, activity gels and activity assays are various methods used to determine protein and activity in both cells and tissue depending on the amount of protein required for each assay. Other techniques including immunohistochemistry and immunogold can further evaluate the levels of the various antioxidant enzymes in tissues and cells. In general, these assays require 24-48 h to complete.

Endothelin-1 inhibits prostate cancer growth in vivo through vasoconstriction of tumor-feeding arterioles.

The vasoactive peptide endothelin-1 (ET-1) has been implicated in promoting the progression of prostate and other cancers though its precise mechanism(s)-of-action remain unclear. To better define the role of ET-1 in prostate cancer progression, we generated prostate cancer cell lines (PC-3 and 22Rv1) that express elevated levels of ET-1. As anticipated, increased ET-1 lead to modest autocrine growth stimulation of PC-3 cells in monolayer culture and increased colony formation in soft agar by both cell lines. Unexpectedly, however, metastatic colonization of 22Rv1 cells expressing elevated levels of ET-1 was reduced, as was the size of subcutaneous tumors produced by both 22Rv1- and PC-3 cells. Based on these data, we hypothesized that high levels of ET-1 may negatively impact the tumor microenvironment. We found that increased ET-1 expression did not consistently inhibit angiogenesis, indicating that this was not the cause of poor tumor growth. As an alternative explanation, we examined whether elevated ET-1 results in local vasoconstriction and thus reduces the blood supply available to the tumor. Consistent with this hypothesis, treatment of mice bearing PC-3 xenografts with a vasodilator increased tumor perfusion and partially restored tumor growth. Moreover, analysis of tumor vascular casts indicated vasoconstriction of tumor-feeding arterioles. Taken together, our data suggest that the local concentration of the ET-1 peptide is critical for determining a balance between its previously unrecognized tumor growth-suppressing activity (vasoconstriction) and known growth-promoting (mitogenesis, survival and angiogenesis) activities. These findings may have implications for the modification of current prostate cancer therapies involving ET-1.

Loss of alpha-dystroglycan laminin binding in epithelium-derived cancers is caused by silencing of LARGE.

The interaction between epithelial cells and the extracellular matrix is crucial for tissue architecture and function and is compromised during cancer progression. Dystroglycan is a membrane receptor that mediates interactions between cells and basement membranes in various epithelia. In many epithelium-derived cancers, beta-dystroglycan is expressed, but alpha-dystroglycan is not detected. Here we report that alpha-dystroglycan is correctly expressed and trafficked to the cell membrane but lacks laminin binding as a result of the silencing of the like-acetylglucosaminyltransferase (LARGE) gene in a cohort of highly metastatic epithelial cell lines derived from breast, cervical, and lung cancers. Exogenous expression of LARGE in these cancer cells restores the normal glycosylation and laminin binding of alpha-dystroglycan, leading to enhanced cell adhesion and reduced cell migration in vitro. Our findings demonstrate that LARGE repression is responsible for the defects in dystroglycan-mediated cell adhesion that are observed in epithelium-derived cancer cells and point to a defect of dystroglycan glycosylation as a factor in cancer progression.

Chronic tempol prevents hypertension, proteinuria, and poor feto-placental outcomes in BPH/5 mouse model of preeclampsia.

Recently we described a mouse model, BPH/5, that spontaneously develops the hallmark clinical features of preeclampsia. BPH/5 exhibit impaired placentation before the onset of hypertension and proteinuria, supporting a causal role for the placenta in the pathogenesis of preeclampsia. Here we tested the hypothesis that an increase in reactive oxygen species (ROS) early in pregnancy results in placental abnormalities leading to the maternal symptoms of preeclampsia. We further hypothesized that chronic antioxidant therapy would ameliorate both feto-placental abnormalities and maternal symptoms. ROS levels measured by dihydroethidium revealed significant increases in oxidative stress in BPH/5 placentas at midgestation compared with C57 controls. This increase in ROS was correlated with reduced expression and activity of cytoplasmic superoxide dismutase in early and midgestation BPH/5 placentas. These abnormalities in placental oxidant factors occurred before the onset of maternal symptoms, suggesting a possible causal link between increased ROS and maternal and feto-placental pathology in this model. In support of this, chronic treatment of BPH/5 with the superoxide dismutase-mimetic Tempol throughout gestation significantly improved fetal growth and survival. Furthermore, Tempol ameliorated pregnancy-induced increases in blood pressure and proteinuria in BPH/5 mothers. We confirmed that Tempol radical was present in plasma, and it normalized ROS levels in all placental zones in BPH/5. These data for the first time demonstrate an important causative role for increased ROS in the placenta in the pathogenesis of preeclampsia in a model that spontaneously develops the disease. The results also strongly suggest the potential utility of antioxidant therapy in treating preeclampsia.

Increased oxidative stress created by adenoviral MnSOD or CuZnSOD plus BCNU (1,3-bis(2-chloroethyl)-1-nitrosourea) inhibits breast cancer cell growth.

Superoxide dismutases (SODs) have been found to decrease tumor formation and angiogenesis. SOD gene therapy, as with many other gene transfer strategies, may not completely inhibit tumor growth on its own. Thus, concomitant therapies are necessary to completely control the spread of this disease. We hypothesized that intratumoral injection of AdSOD in combination with 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) chemotherapy would synergistically inhibit breast cancer growth. Our data indicate that BCNU when combined with SOD overexpression increased oxidative stress as suggested by elevated glutathione disulfide (GSSG) production in one of three breast cancer cell lines tested, at least in part due to glutathione reductase (GR) inactivation. The increased oxidative stress caused by BCNU combined with adenovirally expressed SODs, manganese or copper zinc SOD, decreased growth and survival in the three cell lines tested in vitro, but had the largest effect in the MDA-MB231 cell line, which showed the largest amount of oxidative stress. Delivery of MnSOD and BCNU intratumorally completely inhibited MDA-MB231 xenograft growth and increased nude mouse survival in vivo. Intravenous (iv) BCNU, recapitulating clinical usage, and intratumoral AdMnSOD delivery, to provide tumor specificity, provided similar decreased growth and survival in our nude mouse model. This cancer therapy produced impressive results, suggesting the potential use of oxidative stress-induced growth inhibitory treatments for breast cancer patients.

Overexpression of manganese or copper-zinc superoxide dismutase inhibits breast cancer growth.

We have studied the effects of overexpression of superoxide dismutase (SOD), a tumor suppressor protein that dismutes superoxide radical to H2O2, on breast cancer cell growth in vitro and xenograft growth in vivo. No previous work has directly compared the growth-suppressive effects of manganese SOD (MnSOD) and copper-zinc SOD (CuZnSOD). We hypothesized that either adenoviral MnSOD (AdMnSOD) or adenoviral CuZnSOD (AdCuZnSOD) gene therapy would suppress the growth of human breast cancer cells. After determining the antioxidant profiles of three human breast cell lines, MCF 10A, MDA-MB231, and MCF-7, we measured the effects of MnSOD or CuZnSOD overexpression on cell growth and survival in vitro and in vivo. Results demonstrated that infection with AdMnSOD or AdCuZnSOD increased the activity of the respective enzyme in all three cell lines. In vitro, overexpression of MnSOD or CuZnSOD decreased not only cell growth but also clonogenic survival in a dose- and transgene-dependent manner. In vivo, treatment of tumors with AdMnSOD or AdCuZnSOD decreased xenograft growth compared to controls. The first direct comparison of MnSOD to CuZnSOD overexpression indicated that CuZnSOD and MnSOD were similarly effective at suppressing cancer cell growth.

Delayed radioprotection by nuclear transcription factor kappaB -mediated induction of manganese superoxide dismutase in human microvascular endothelial cells after exposure to the free radical scavenger WR1065.

The free radical scavenger WR1065 (SH) is the active thiol form of the clinically approved cytoprotector amifostine. At doses of 40 microM and 4 mM it can activate the redox-sensitive nuclear transcription factor kappaB (NFkappaB) and elevate the expression of the antioxidant gene manganese superoxide dismutase (MnSOD) in human microvascular endothelial cells (HMEC). MnSOD contains binding motifs for a number of transcription factors other than NFkappaB and codes for a potent antioxidant enzyme localized in the mitochondria that is known to confer enhanced radiation resistance to cells. The purpose of this study was to determine the effect of WR1065 exposure on the various transcription factors known to affect MnSOD expression along with the subsequent kinetics of intracellular elevation of MnSOD protein levels and associated change in sensitivity to ionizing radiation in HMEC. Cells were grown to confluence and exposed to WR1065 for 30 min. Affects on the transcription factors AP1, AP2, CREB, NFkappaB, and Sp1 were monitored as a function of time ranging from 30 min to 4 h after drug exposure using a gel-shift assay. Only NFkappaB exhibited a marked activation and that occurred 30 min following the cessation of drug exposure. MnSOD protein levels, as determined by Western blot analysis, increased up to 16-fold over background control levels by 16 h following drug treatment, and remained at 10-fold or higher levels for an additional 32 h. MnSOD activity was evaluated using a gel-based assay and was found to be active throughout this time period. HMEC were irradiated with X-rays either in the presence of 40 microM or 4 mM WR1065 or 24 h after its removal when MnSOD levels were most elevated. No protection was observed for cells irradiated in the presence of 40 microM WR1065. In contrast, a 4 mM dose of WR1065 afforded an increase in cell survival by a factor of 2. A "delayed radioprotective" effect was, however, observed when cells were irradiated 24 h later, regardless of the concentration of WR1065 used. This effect is characterized as an increase in survival at the 2 Gy dose point, i.e., a 40% increase in survival, and an increase in the initial slope of the survival curve by a factor of 2. The anti-inflammatory sesquiterpene lactone, Helenalin, is an effective inhibitor of NFkappaB activation. HMEC were exposed to Helenalin for 2 h at a nontoxic concentration of 5 microM prior to exposure to WR1065. This treatment not only inhibited activation of NFkappaB by WR1065, but also inhibited the subsequent elevation of MnSOD and the delayed radioprotective effect. A persistent marked elevation of MnSOD in cells following their exposure to a thiol-containing reducing agent such as WR1065 can result in an elevated resistance to the cytotoxic effects of ionizing radiation and represents a novel radioprotection paradigm.

Manganese superoxide dismutase suppresses hypoxic induction of hypoxia-inducible factor-1alpha and vascular endothelial growth factor.

Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that governs cellular responses to reduced O2 availability by mediating crucial homeostatic processes. HIF-1 is composed of an HIF-1alpha subunit and an HIF-1beta subunit. HIF-1alpha is degraded following enzyme-dependent hydroxylation of prolines of HIF-1alpha in the presence of molecular oxygen, Fe2+, alpha-ketoglutarate, and ascorbate. These cofactors contribute to the redox environment of cells. The antioxidant enzyme manganese superoxide dismutase (MnSOD) also modulates the cellular redox environment. Here we show that MnSOD suppressed hypoxic accumulation of HIF-1alpha protein in human breast carcinoma MCF-7 cells. This suppression was biphasic depending on MnSOD activity. At low levels of MnSOD activity, HIF-1alpha protein accumulated under hypoxic conditions. At moderate levels of MnSOD activity (two- to six-fold increase compared to parent cells), these accumulations were blocked. However, at higher levels of MnSOD activity (>6-fold increase), accumulation of HIF-1alpha protein was again observed. This biphasic modulation was observed under both 1 and 4% O2. Coexpression of mitochondrial hydrogen peroxide-removing proteins prevented the accumulation of HIF-1alpha protein in cells with high levels of MnSOD; this effect demonstrates that the restabilization of HIF-1alpha observed in high MnSOD overexpressors is probably due to hydrogen peroxide, most likely produced from MnSOD. Hypoxic induction of vascular endothelial growth factor (VEGF) protein was also suppressed by elevated MnSOD activity and its levels reflected HIF-1alpha protein levels. These observations demonstrated that HIF-1alpha accumulation and VEGF expression could be modulated by the antioxidant enzyme MnSOD.

MnSOD inhibits proline oxidase-induced apoptosis in colorectal cancer cells.

Proline oxidase (POX), localized on inner mitochondrial membranes, is encoded by a p53-induced gene and metabolically participates in p53-induced apoptosis. Previously, we showed that POX catalyzed the generation of reactive oxygen species (ROS). We and others have demonstrated that overexpression of POX, independent of p53, causes apoptotic cell death in a variety of cancer cells. But a necessary role for ROS remains uncertain. Therefore, we asked whether superoxide dismutases (SOD) and catalase (CAT), important antioxidant enzymes, might interfere with the POX-dependent induction of apoptosis. In this study, we used DLD-1 colorectal cancer cells stably transfected with the POX gene under the control of a tetracycline-inducible promoter. When doxycycline was removed from the culture medium and the expression of POX was induced, apoptotic cell death was initiated. To examine the importance of the ROS-dependent component of the pathway, we infected DLD-1 POX cells with recombinant adenoviruses containing MnSOD, CuZnSOD, CAT or varying combinations of these adenoviruses followed by induced expression of POX. The expression of MnSOD inhibited POX-induced apoptosis, but others did not. Mechanistically, mitochondria-localized MnSOD dramatically reduced the release of cytochrome c to cytosol by POX. Compared with control cells, MnSOD-expressing DLD-1 POX cells generated a higher concentration of H2O2 owing to dismutation of superoxide radicals, which was elevated by POX. Thus, these data further suggest that the generation of superoxide radicals plays a crucial role in POX-induced apoptosis and the process is partially blocked by MnSOD.

Endogenous production and exogenous exposure to nitric oxide augment doxorubicin cytotoxicity for breast cancer cells but not cardiac myoblasts.

We studied the effect of nitric oxide (*NO) on the anticancer activity of doxorubicin. When MCF-7 human breast cancer cells were exposed to an aqueous solution of *NO delivered as a bolus 30 min prior to doxorubicin, the cytotoxic effect as measured in a clonogenic assay was increased (doxorubicin alone, 40% survival, doxorubicin plus *NO, 5% survival). The *NO donor diethylamine nitric oxide, but not inactivated donor, also yielded an increase in doxorubicin cytotoxicity. The sequence was important since the simultaneous application of *NO with doxorubicin yielded only a small augmentation of effect, and the exposure of the cells to doxorubicin prior to the *NO obliterated the augmentation. Prior depletion of glutathione by incubation of the cells for 24h with D,L-buthionine-S,R-sulfoximine (BSO) further increased the cytotoxicity so that BSO plus *NO plus doxorubicin killed all of the clones. MCF-7 cells transduced with inducible nitric oxide synthase gene (iNOS) through an adenoviral vector overexpressed iNOS and produced increased amounts of nitrite, an indicator of increased *NO production. These iNOS transduced cells were more susceptible to doxorubicin than vector control or wild-type cells. Cell cycle progression of iNOS transduced cells was not different from controls. Likewise, iNOS transduction resulted in no change in cellular glutathione levels. For comparison, we examined the effect of iNOS transduction on the sensitivity of MCF-7 to edelfosine, a membrane-localizing anticancer drug without direct DNA interaction. Insertion of the iNOS had no effect on killing of the MCF-7 cells by this ether lipid class drug. We also tested the effect of iNOS transduction on doxorubicin sensitivity of H9c2 rat heart-derived myoblasts. We found no augmentation of cytotoxicity by *NO, and this observation offers potential therapeutic tumor selectivity by using *NO with doxorubicin. Therefore, we conclude that *NO produced intracellularly by iNOS overexpression or delivered as a bolus sensitizes human breast cancer cells in culture to doxorubicin, but not to a cardiac cell line or to edelfosine. This augmentation is not due to a modulation of cell cycle distribution or measurable cellular glutathione resulting from the transduction.

Redox regulation of pancreatic cancer cell growth: role of glutathione peroxidase in the suppression of the malignant phenotype.

Pancreatic cancer has low levels of antioxidant enzymes including manganese superoxide dismutase (MnSOD), which converts superoxide radical (O(2)(*-)) into hydrogen peroxide (H(2)O(2)), and glutathione peroxidase (GPx), which converts H(2)O(2) into water. Recent studies have demonstrated that overexpression of MnSOD has a tumor-suppressive effect in pancreatic cancer. However, GPx overexpression has been shown to reverse the tumor cell growth inhibition caused by MnSOD overexpression in other types of cancer. Our aims were to determine if overexpression of GPx alters in vitro pancreatic cancer cell behavior and if delivering the GPx gene directly to tumor xenografts alters growth and survival. In vitro, AdGPx slowed tumor growth by 39% and AdMnSOD slowed tumor growth by 35%. AdGPx also decreased plating efficiency and growth in soft agar. The combination of AdGPx and AdMnSOD had the greatest effect on tumor cell growth suppression with a 71% reduction in cell growth compared to controls. In vivo, either AdGPx or AdMnSOD alone slowed tumor growth by 51% and 54%, respectively, while the combination of AdGPx and AdMnSOD potentiated tumor growth suppression by 81% of controls and increased animal survival. GPx may be a tumor suppressor gene in pancreatic cancer. Delivery of the GPx gene alone or in combination with the MnSOD gene may prove beneficial for treatment of pancreatic cancer.

Dicumarol inhibition of NADPH:quinone oxidoreductase induces growth inhibition of pancreatic cancer via a superoxide-mediated mechanism.

NADPH:quinone oxidoreductase (NQO(1)), a homodimeric, ubiquitous, flavoprotein, catalyzes the two-electron reduction of quinones to hydroquinones. This reaction prevents the one-electron reduction of quinones by cytochrome P450 reductase and other flavoproteins that would result in oxidative cycling with generation of superoxide (O(2)(.-)). NQO(1) gene regulation may be up-regulated in some tumors to accommodate the needs of rapidly metabolizing cells to regenerate NAD(+). We hypothesized that pancreatic cancer cells would exhibit high levels of this enzyme, and inhibiting it would suppress the malignant phenotype. Reverse transcription-PCR, Western blots, and activity assays demonstrated that NQO(1) was up-regulated in the pancreatic cancer cell lines tested but present in very low amounts in the normal human pancreas. To determine whether inhibition of NQO(1) would alter the malignant phenotype, MIA PaCa-2 pancreatic cancer cells were treated with a selective inhibitor of NQO(1), dicumarol. Dicumarol increased intracellular production of O(2)(.-), as measured by hydroethidine staining, and inhibited cell growth. Both of these effects were blunted with infection of an adenoviral vector containing the cDNA for manganese superoxide dismutase. Dicumarol also inhibited cell growth, plating efficiency, and growth in soft agar. We conclude that inhibition of NQO(1) increases intracellular O(2)(.-) production and inhibits the in vitro malignant phenotype of pancreatic cancer. These mechanisms suggest that altering the intracellular redox environment of pancreatic cancer cells may inhibit growth and delineate a potential strategy directed against pancreatic cancer.

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides.

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.

Inhibition of oral cancer cell growth by adenovirusMnSOD plus BCNU treatment.

We hypothesized that inhibitors of peroxide removal, such as BCNU, an indirect inhibitor of glutathione peroxidase (GPx), and 3-amino-1,2,4-triazole (AT), a direct inhibitor of catalase (CAT), should cause toxicity to cancer cells after manganese superoxide dismutase (MnSOD) overexpression due to elevated peroxide levels. In vitro, hamster cheek pouch carcinoma cells (HCPC-1) and human oral squamous carcinoma cells (SCC-25) were infected with various combinations of adenovirus containing MnSOD cDNA (AdMnSOD). Cells were then treated with or without BCNU and assayed for viability using Annexin/PI staining and flow cytometry. In AdMnSOD plus BCNU-treated SCC-25 and HCPC-1 cells, a 30-60% decrease in cell viability was observed compared to BCNU alone. In vivo, HCPC-1 and SCC-25 xenografts were allowed to grow to approximately 70 mm(3) and 10(9) plaque forming units (pfu) of AdMnSOD were injected directly into the tumors. Two days later, 15 or 30 mg/kg BCNU was injected intratumorally. Tumor growth was greatly inhibited (4- to 20-fold) by this combined treatment, as well as increasing animal survival. Tumor volume could be decreased further by giving multiple doses of AdMnSOD or inhibiting catalase activity with AT. These results suggest that, by using these combination therapies, a significant decrease in tumor mass can be achieved.

Deficiency of glutathione peroxidase-1 sensitizes hyperhomocysteinemic mice to endothelial dysfunction.

OBJECTIVE: We tested the hypothesis that deficiency of cellular glutathione peroxidase (GPx-1) enhances susceptibility to endothelial dysfunction in mice with moderate hyperhomocysteinemia. METHODS AND RESULTS: Mice that were wild type (Gpx1+/+), heterozygous (Gpx1+/-), or homozygous (Gpx1-/-) for the mutated Gpx1 allele were fed a control diet or a high-methionine diet for 17 weeks. Plasma total homocysteine was elevated in mice on the high-methionine diet compared with mice on the control diet (23+/-3 versus 6+/-0.3 micromol/L, respectively; P<0.001) and was not influenced by Gpx1 genotype. In mice fed the control diet, maximal relaxation of the aorta in response to the endothelium-dependent dilator acetylcholine (10(-5) mol/L) was similar in Gpx1+/+, Gpx1+/-, and Gpx1-/- mice, but relaxation to lower concentrations of acetylcholine was selectively impaired in Gpx1-/- mice (P<0.05 versus Gpx1+/+ mice). In mice fed the high-methionine diet, relaxation to low and high concentrations of acetylcholine was impaired in Gpx1-/- mice (maximal relaxation 73+/-6% in Gpx1-/- mice versus 90+/-2% in Gpx1+/+ mice, P<0.05). No differences in vasorelaxation to nitroprusside or papaverine were observed between Gpx1+/+ and Gpx1-/- mice fed either diet. Dihydroethidium fluorescence, a marker of superoxide, was elevated in Gpx1-/- mice fed the high-methionine diet (P<0.05 versus Gpx1+/+ mice fed the control diet). CONCLUSIONS: These findings demonstrate that deficiency of GPx-1 exacerbates endothelial dysfunction in hyperhomocysteinemic mice and provide support for the hypothesis that hyperhomocysteinemia contributes to endothelial dysfunction through a peroxide-dependent oxidative mechanism.

Delayed cytoprotection after enhancement of Sod2 (MnSOD) gene expression in SA-NH mouse sarcoma cells exposed to WR-1065, the active metabolite of amifostine.

SA-NH mouse sarcoma cells were grown to confluence and then exposed to either 40 microM or 4 mM of WR-1065, i.e. the active thiol form of amifostine, for 30 min and then washed. Total RNA and protein were isolated at various times up to 24 h after exposure. Both concentrations of WR-1065 were equally effective in affecting Sod2 (also known as MnSOD) gene expression and protein levels. Northern blot analysis using a mouse cDNA probe revealed three Sod2 transcripts of 1, 4 and 6 kb. Expression of both the 4- and 6-kb transcripts increased by 20 and 60%, respectively, and remained elevated over a period of 4 to 20 h. Sod2 protein levels, as determined by Western blot analysis, increased 15-fold over background control levels over the same interval. Sod2 protein was evaluated using activity gels and was found to be active. SA-NH cells were irradiated with X rays either in the presence of 40 microM or 4 mM WR-1065 or 24 h later after its removal, when Sod2 protein levels were most elevated. No protection was observed for cells irradiated in the presence of 40 microM WR-1065. In contrast, survival after a dose of 2 Gy was elevated 1.27-, 1.14- and 1.20-fold in SA-NH cells irradiated in the presence of 4 mM WR-1065 or 24 h after exposure of the cells to 40 microM and 4 mM WR-1065, respectively. The increased survival levels observed 24 h after exposure to WR-1065 represents a delayed radioprotective effect of WR-1065 and corresponds to the time at which Sod2 protein levels are most elevated. These data demonstrate a novel mechanism for radioprotection by WR-1065 and suggest a new potential concern regarding the issue of tumor protection.